Hieff NGS™ RNA Lib Prep 384 CDI Primer for Illumina, Set 1 (96 index) -12414ES

1) The concentration of PE Adapter in this kit is 15 μM, and the amount of adapters used for individual library construction is adjusted according to the recommended amount of library construction kit. Index Primer has a concentration of 10 μM.

2) The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library. Index Primer provides Barcode sequence tags for distinguishing samples during high-throughput sequencing.

3) Each set of this kit contains 8 of i5 Index Primers (RP 5xx) and 12 of i7 Index Primers (RP 7xx), which can be combined with each other to construct 96 different combinations of double-ended Index labeled libraries. 2 Sets offer a total of 16 of i5 Index Primers and 24 of i7 Index Primers. You can use the i5 Index Primer (or i7 Index Primer) from Cat#12414 and the i7 Index Primer (or i5 Index Primer) in Cat#12415 to build up to 384 different combinations of double-ended Index labeled libraries.

4) Do not heat the adapter, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. The adapters are need to avoid repeated freeze-thaw, and it is recommended to store it in aliquots and store it at 4°C for a short time.

5) The sequencing library structure constructed using the Hieff NGS® RNA 384 CDI Primer for Illumina® kit is as follows:



6) For your safety and health, please wear a lab coat and wear disposable gloves.
7) This product is for scientific research purposes only!

Instructions
1. Use of adapters: Dilute to an appropriate concentration according to the recommended dosage for different input amounts in the library construction manual used.
2. Use of Index Primer: Prepare the reaction system according to the library construction manual Chinese the library amplification system (as shown in the table below), and the reaction procedure is set according to the procedure in the library construction manual.

 

 

Sequence Information

PE Adapter for Illumina：

5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´

5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

i5 Index Primer for Illumina：

5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´

i7 Index Primer for Illumina：

5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´

[i5 Index]8 bp of i5 Index seqience，[i7 Index]8 bp of i7 Index sequence.

The Index name corresponding to each primer, the Index sequence contained in the primer, and the corresponding Index sequence information during sequencing are shown in the following table: