Description
TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA.
Features
Excellent cut-and-paste performance.
The integrity of dsDNA product end closure is greater than 90%.
Applications
DNA Enzymatic Synthesis.
Specifications
Unit Definition |
One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30oC for 30 minutes. |
Recognition Sites |
TATCAGCACACAATTGCCCATTATACGC↓GCGTATAATGGACTATTGTGTGCTGATA ATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT |
Heat Inactivation |
75oC for 5 min |
Components
Components No. |
Name |
14540ES72 |
14540ES80 |
14540ES90 |
14540-A |
TelN Protelomerase (5 U/μL) |
50 μL |
200 μL |
1 mL |
14540-B |
10 X TelN Reaction Buffer |
250 μL |
1 mL |
5 X 1 mL |
Shipping and Storage
This product should be stored at -25 ~ -15oC for 1 years.
Figures
Figure 1.Protelomerase cleavage activity detection of TelN M:Marker, C: supercoiled plasmid control
Figure 2.TelN Protelomerase end closure integrity test. C1: plasmid containing TelN recognition site, without TelN Protelomerase; C2: plasmid containing TelN recognition site, TelN Protelomerase, without T5 exonuclease; Plasmid: plasmid containing TelN recognition site.
Documents:
Safety Data Sheet
Manuals
Payment & Security
Your payment information is processed securely. We do not store credit card details nor have access to your credit card information.
Inquiry
You may also like
FAQ
The product is for research purposes only and is not intended for therapeutic or diagnostic use in humans or animals. Products and content are protected by patents, trademarks, and copyrights owned by Yeasen Biotechnology. Trademark symbols indicate the country of origin, not necessarily registration in all regions.
Certain applications may require additional third-party intellectual property rights.
Yeasen is dedicated to ethical science, believing our research should address critical questions while ensuring safety and ethical standards.